| Description | These cells will be suitable for studying the function of Sirt7 and Sirtuin protein family |
| Tissue/Organ/Organ System | Lung |
| Size | 1*106 cells/1.0 ml |
| Species | Human |
| Format | Frozen |
| Shipping Info | Dry Ice |
| Quality Control | 1) Immunofluorescence; 2) DNA analysis and qPCR; 3) AgNOR staining |
| Storage Conditions | Liquid Nitrogen |
| Growth Properties | Adherent |
| Categories | Drug Discovery Cell Lines |
| Seeding Density | 10,000 - 20,000 cells/cm2 |
| Applications | For Research Use Only |
| Cell Morphology | Epithelial-like |
| Donor Age | 43 years old |
| Donor Gender | Male |
| Expression Profile | Puromycin resistance at the concentration of 5 ug/mL. The cells stably express the short hairpin RNA (shRNA) scramble sequence: 5'-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTT AGG-3' and the Sirt7 specific shRNA 5'- CCGGGTCCAGCCTGAAGGTTCTAAACTCGAGTTTAGAACCTTCAGGCTGGACTTTTTG-3'. |
| Population Doubling Time | 43 - 53 hours |
| Preservation Protocol | 1. Freeze Medium: Complete growth medium with 20% FBS and 10% DMSO. 2. Storage Temperature: Liquid Nitrogen vapour phase. |
| Price | Inquiry |
